Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #66111)


Item Catalog # Description Quantity Price (USD)
Plasmid 66111 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pLenti pRRL-SV40(puro)_CMV(mcs)
  • Backbone size w/o insert (bp) 7711
  • Total vector size (bp) 8110
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    Second generation Rac1 FRET biosensor
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter CMV
  • Tag / Fusion Protein
    • His-Myc (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGACTCTAGAGGATCCGGAGATATA
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-Rac1-2G was a gift from Olivier Pertz (Addgene plasmid # 66111 ; ; RRID:Addgene_66111)
  • For your References section:

    SrGAP2-Dependent Integration of Membrane Geometry and Slit-Robo-Repulsive Cues Regulates Fibroblast Contact Inhibition of Locomotion. Fritz RD, Menshykau D, Martin K, Reimann A, Pontelli V, Pertz O. Dev Cell. 2015 Sep 29. pii: S1534-5807(15)00582-1. doi: 10.1016/j.devcel.2015.09.002. 10.1016/j.devcel.2015.09.002 PubMed 26439400