-
PurposeAAVS1 safe harbor gene targeting donor expressing CAG-driven copGFP, compatible with pZT-AAVS1 TALENs
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAVS1P-iRMCE
- Backbone size w/o insert (bp) 10001
- Total vector size (bp) 10760
-
Modifications to backbonecopGFP was cloned under CAG promoter
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecopGFP
-
SpeciesSynthetic
-
Insert Size (bp)759
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer gggcggggttcggcttctgg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVS1P-iCAG.copGFP was a gift from Jizhong Zou (Addgene plasmid # 66577 ; http://n2t.net/addgene:66577 ; RRID:Addgene_66577) -
For your References section:
Transcription activator-like effector nuclease (TALEN)-mediated CLYBL targeting enables enhanced transgene expression and one-step generation of dual reporter human induced pluripotent stem cell (iPSC) and neural stem cell (NSC) lines. Cerbini T, Funahashi R, Luo Y, Liu C, Park K, Rao M, Malik N, Zou J. PLoS One. 2015 Jan 14;10(1):e0116032. doi: 10.1371/journal.pone.0116032. eCollection 2015. PONE-D-14-41442 [pii] PubMed 25587899