pX330.iGFP3
(Plasmid
#66583)
-
PurposesgRNA for iGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66583 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiGFP
-
gRNA/shRNA sequencegatatcgaattcctgcagcc
-
GenBank ID
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330.iGFP3 was a gift from Wen Xue (Addgene plasmid # 66583 ; http://n2t.net/addgene:66583 ; RRID:Addgene_66583) -
For your References section:
A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Li Y, Park A, Mou H, Colpan C, Bizhanova A, Akama-Garren E, Joshi N, Hendrickson EA, Feldser D, Yin H, Anderson DG, Jacks T, Weng Z, Xue W. Genome Biol. 2015 May 28;16(1):111. 10.1186/s13059-015-0680-7 [pii] PubMed 26018130