Skip to main content

P119 C-Check
(Plasmid #66817)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66817 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR8
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2575
  • Total vector size (bp) 7120
  • Modifications to backbone
    no
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    truncated Enhanced Green Fluorescent Protein and asRED
  • Alt name
    EGFP, asRED
  • Alt name
    C-Check
  • Species
    Synthetic
  • Insert Size (bp)
    4545
  • Promoter PGK and CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer TTGATGCCTGGCAGTTCCCT
  • 3′ sequencing primer CGAACCGAACAGGCTTATGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P119 C-Check was a gift from Yonglun Luo (Addgene plasmid # 66817 ; http://n2t.net/addgene:66817 ; RRID:Addgene_66817)
  • For your References section:

    Enhanced genome editing in mammalian cells with a modified dual-fluorescent surrogate system. Zhou Y, Liu Y, Hussmann D, Brogger P, Al-Saaidi RA, Tan S, Lin L, Petersen TS, Zhou GQ, Bross P, Aagaard L, Klein T, Ronn SG, Pedersen HD, Bolund L, Nielsen AL, Sorensen CB, Luo Y. Cell Mol Life Sci. 2016 Jan 11. 10.1007/s00018-015-2128-3 [pii] PubMed 26755436