-
Purposehuman VPS33A ORF was inserted into pMXsIP SPGFP-GS Ci2 vector
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXs-IP
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 5847
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVacuolar protein sorting 33 homolog A (S. cerevisiae) (VPS33A)
-
SpeciesH. sapiens (human)
-
Entrez GeneVPS33A (a.k.a. MPSPS)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The P21R mutation in VPS33A has no functional consequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXsIP GFP-VPS33A was a gift from Noboru Mizushima (Addgene plasmid # 67022 ; http://n2t.net/addgene:67022 ; RRID:Addgene_67022) -
For your References section:
The HOPS complex mediates autophagosome-lysosome fusion through interaction with syntaxin 17. Jiang P, Nishimura T, Sakamaki Y, Itakura E, Hatta T, Natsume T, Mizushima N. Mol Biol Cell. 2014 Apr;25(8):1327-37. doi: 10.1091/mbc.E13-08-0447. Epub 2014 Feb 19. 10.1091/mbc.E13-08-0447 PubMed 24554770