Frt-Atg-Hygro-CMV-green (mWasabi)-PA-F3
(Plasmid
#67276)
-
PurposeRMCE donor plasmid for FlpO. the marker gene is green fluorescent (mWasabi) with PA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAmp
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGFP (mWasabi)
-
Insert Size (bp)700
- Promoter CMV
-
Tag
/ Fusion Protein
- F3 (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe (unknown if destroyed)
- 3′ cloning site XcmI (unknown if destroyed)
- 5′ sequencing primer TCAACCTGGAGGTGAAGGAG
- 3′ sequencing primer TCAAGACCATCTACAGGGCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehygro
-
Insert Size (bp)1000
-
Tag
/ Fusion Protein
- Frt (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site MfeI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer GCCCAAAGCATCAGCTCATC
- 3′ sequencing primer ATTTCGGCTCCAACAATGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Frt-Atg-Hygro-CMV-green (mWasabi)-PA-F3 was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 67276 ; http://n2t.net/addgene:67276 ; RRID:Addgene_67276) -
For your References section:
Recombinase-Mediated Cassette Exchange (RMCE)-in Reporter Cell Lines as an Alternative to the Flp-in System. Callesen MM, Berthelsen MF, Lund S, Fuchtbauer AC, Fuchtbauer EM, Jakobsen JE. PLoS One. 2016 Aug 19;11(8):e0161471. doi: 10.1371/journal.pone.0161471. eCollection 2016. 10.1371/journal.pone.0161471 PubMed 27541869