pdx1-mTQ2-P2A-FlpO-PA
(Plasmid
#67279)
-
PurposePancreas specific expression of the FlpO recombinase controlled by the pdx1 promoter . FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon context
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneamp
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 13000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemTQ2=mturquoise2 blue fluorescent gene
-
Speciesblue fluorescent gene
-
Insert Size (bp)800
- Promoter pdx
-
Tag
/ Fusion Protein
- linked to FlpO through an P2A ribosomal skipping site (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer CACCATGGACCCTCATGATA
- 3′ sequencing primer aactccagcaggaccatgt
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFlpO recombinase
-
Insert Size (bp)1300
- Promoter pdx
-
Tag
/ Fusion Protein
- mTQ2 blue fluorescent (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer gatcacatggtcctgctg
- 3′ sequencing primer atcagcaaggagatgatcgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdx1-mTQ2-P2A-FlpO-PA was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 67279 ; http://n2t.net/addgene:67279 ; RRID:Addgene_67279)