Skip to main content

pdx1-mTQ2-P2A-FlpO-PA
(Plasmid #67279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67279 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    amp
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 13000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mTQ2=mturquoise2 blue fluorescent gene
  • Species
    blue fluorescent gene
  • Insert Size (bp)
    800
  • Promoter pdx
  • Tag / Fusion Protein
    • linked to FlpO through an P2A ribosomal skipping site (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CACCATGGACCCTCATGATA
  • 3′ sequencing primer aactccagcaggaccatgt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FlpO recombinase
  • Insert Size (bp)
    1300
  • Promoter pdx
  • Tag / Fusion Protein
    • mTQ2 blue fluorescent (N terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer gatcacatggtcctgctg
  • 3′ sequencing primer atcagcaaggagatgatcgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdx1-mTQ2-P2A-FlpO-PA was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 67279 ; http://n2t.net/addgene:67279 ; RRID:Addgene_67279)