Puro-TTL-wt-TTF-1
(Plasmid
#67657)
-
PurposeTo create a dox-on inducible expression of human wt-TTF-1 cDNA in cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67657 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePuro-TTL
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6602
- Total vector size (bp) 7718
-
Modifications to backboneTTF-1 insert cloned into the Xho I site
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThyroid Transcription Factor 1
-
Alt nameTTF-1
-
Alt nameNKX2-1
-
Alt nameTTF1 or TITF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1116
-
GenBank IDNM_003317
-
Entrez GeneNKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)
-
Tag
/ Fusion Protein
- N/A (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer AATTAATTCGAGCTCGGTACCCGGGG
- 3′ sequencing primer CAGACTGCCTTGGGAAAAGCGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Puro-TTL-wt-TTF-1 was a gift from David Mu (Addgene plasmid # 67657 ; http://n2t.net/addgene:67657 ; RRID:Addgene_67657) -
For your References section:
MicroRNA-33a mediates the regulation of high mobility group AT-hook 2 gene (HMGA2) by thyroid transcription factor 1 (TTF-1/NKX2-1). Rice SJ, Lai SC, Wood LW, Helsley KR, Runkle EA, Winslow MM, Mu D. J Biol Chem. 2013 Jun 7;288(23):16348-60. doi: 10.1074/jbc.M113.474643. Epub 2013 Apr 26. 10.1074/jbc.M113.474643 PubMed 23625920