Skip to main content

PNCA-GFP-dYY1
(Plasmid #67791)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67791 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNCA
  • Backbone manufacturer
    Addgene Plasmid 17363
  • Backbone size w/o insert (bp) 8000

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MMLV-LTR-GFP
  • Species
    Moloney murine leukemia virus
  • Mutation
    Deletion of LTR U3 YY1 binding domain

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Amp-R (ATAATACCGCGCCACATAGC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The region containing the dYY1 mutation has not been experimentally confirmed by Addgene.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PNCA-GFP-dYY1 was a gift from Stephen Goff (Addgene plasmid # 67791 ; http://n2t.net/addgene:67791 ; RRID:Addgene_67791)
  • For your References section:

    Proviral silencing in embryonic cells is regulated by Yin Yang 1. Schlesinger S, Lee AH, Wang GZ, Green L, Goff SP. Cell Rep. 2013 Jul 11;4(1):50-8. doi: 10.1016/j.celrep.2013.06.003. Epub 2013 Jun 27. 10.1016/j.celrep.2013.06.003 PubMed 23810560