-
PurposeMammalian expression vector driving Mouse ML1Nwt (2xML1N domain 7Q mutant version) fused to EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5182
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameML1N*2(7Q)-EGFP
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer RZPD Sugano R1 (CAGGTTCAGGGGGAGGTGTGG) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ML1Nmut_in_pEGFP-C1 was a gift from Rob Parton (Addgene plasmid # 67796 ; http://n2t.net/addgene:67796 ; RRID:Addgene_67796) -
For your References section:
Modular Detection of GFP-Labeled Proteins for Rapid Screening by Electron Microscopy in Cells and Organisms. Ariotti N, Hall TE, Rae J, Ferguson C, McMahon KA, Martel N, Webb RE, Webb RI, Teasdale RD, Parton RG. Dev Cell. 2015 Nov 23;35(4):513-25. doi: 10.1016/j.devcel.2015.10.016. Epub 2015 Nov 12. 10.1016/j.devcel.2015.10.016 PubMed 26585296