Skip to main content

pSG5-hEKLF
(Plasmid #67835)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67835 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSG5
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4076
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EKLF
  • Species
    H. sapiens (human)
  • Entrez Gene
    KLF1 (a.k.a. EKLF, EKLF/KLF1)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
  • 3′ sequencing primer SV40 poly A Reverse
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Full-length human EKLF cDNA was generated from bone marrow total RNA. This was used for activation studies.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSG5-hEKLF was a gift from James Bieker (Addgene plasmid # 67835 ; http://n2t.net/addgene:67835 ; RRID:Addgene_67835)
  • For your References section:

    Structural and functional characterization of an atypical activation domain in erythroid Kruppel-like factor (EKLF). Mas C, Lussier-Price M, Soni S, Morse T, Arseneault G, Di Lello P, Lafrance-Vanasse J, Bieker JJ, Omichinski JG. Proc Natl Acad Sci U S A. 2011 Jun 28;108(26):10484-9. doi: 10.1073/pnas.1017029108. Epub 2011 Jun 13. 10.1073/pnas.1017029108 PubMed 21670263