Skip to main content

pC4-RhE-FRB-Fis1
(Plasmid #68056)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68056 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pC4-RhE (now pHet-1)
  • Backbone manufacturer
    ARIAD (now Clontech)
  • Backbone size w/o insert (bp) 5329
  • Total vector size (bp) 5473
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fis1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    183
  • Mutation
    Fis1 tail (aa 93-152)
  • Entrez Gene
    FIS1 (a.k.a. CGI-135, TTC11)
  • Tag / Fusion Protein
    • FRB (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMVf: CGC AAA TGG GCG GTA GGC GTG
  • 3′ sequencing primer Bglob-intron-R: TTTGCCCCCTCCATATAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC4-RhE-FRB-Fis1 was a gift from Richard Youle (Addgene plasmid # 68056 ; http://n2t.net/addgene:68056 ; RRID:Addgene_68056)
  • For your References section:

    p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both. Narendra D, Kane LA, Hauser DN, Fearnley IM, Youle RJ. Autophagy. 2010 Nov;6(8):1090-106. 13426 [pii] PubMed 20890124