SepOTSκ
(Plasmid
#68291)
-
PurposePhosphoserine orthogonal translation system
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepKD
-
Modifications to backbonepKD is derived from pKK223-3 (Pharmacia). This plasmid encodes a variant of the phosphoserine orthogonal translation system. Another plasmid encoding a protein of interest with TAG at the proper position is needed for recombinant phosphoprotein expression. See article and supplementary information for cloning information.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThis plasmid is slow growing and may take up to 24 hours to produce colonies.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSepRS/EF-Sep, 4xtRNA-Sep-A37
-
SpeciesSynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See supplementary information accompanying article for additional cloning information. We recommend introducing this plasmid into a recoded strain of E. coli (no genomic TAG codons) for high-efficiency phoshoprotein expression.
For plasmid propagation use NEB Stable cells. Check tRNA locus with the following primer pair: TCATTACAGAAACGGCTTTT, CATCGCCGCTTCCACTTTTT
The correct size of expected PCR product is 1.4kb.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SepOTSκ was a gift from Jesse Rinehart (Addgene plasmid # 68291 ; http://n2t.net/addgene:68291 ; RRID:Addgene_68291) -
For your References section:
A flexible codon in genomically recoded Escherichia coli permits programmable protein phosphorylation. Pirman NL, Barber KW, Aerni HR, Ma NJ, Haimovich AD, Rogulina S, Isaacs FJ, Rinehart J. Nat Commun. 2015 Sep 9;6:8130. doi: 10.1038/ncomms9130. 10.1038/ncomms9130 PubMed 26350500