Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SepOTSκ
(Plasmid #68291)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68291 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKD
  • Modifications to backbone
    pKD is derived from pKK223-3 (Pharmacia). This plasmid encodes a variant of the phosphoserine orthogonal translation system. Another plasmid encoding a protein of interest with TAG at the proper position is needed for recombinant phosphoprotein expression. See article and supplementary information for cloning information.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    This plasmid is slow growing and may take up to 24 hours to produce colonies.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SepRS/EF-Sep, 4xtRNA-Sep-A37
  • Species
    Synthetic

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See supplementary information accompanying article for additional cloning information. We recommend introducing this plasmid into a recoded strain of E. coli (no genomic TAG codons) for high-efficiency phoshoprotein expression.

For plasmid propagation use NEB Stable cells. Check tRNA locus with the following primer pair: TCATTACAGAAACGGCTTTT, CATCGCCGCTTCCACTTTTT

The correct size of expected PCR product is 1.4kb.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SepOTSκ was a gift from Jesse Rinehart (Addgene plasmid # 68291 ; http://n2t.net/addgene:68291 ; RRID:Addgene_68291)
  • For your References section:

    A flexible codon in genomically recoded Escherichia coli permits programmable protein phosphorylation. Pirman NL, Barber KW, Aerni HR, Ma NJ, Haimovich AD, Rogulina S, Isaacs FJ, Rinehart J. Nat Commun. 2015 Sep 9;6:8130. doi: 10.1038/ncomms9130. 10.1038/ncomms9130 PubMed 26350500