LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
(Plasmid
#68345)
-
PurposeA Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAmp
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 13400
-
Vector typeMammalian Expression, CRISPR ; Flp/Frt
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepuromycin
-
SpeciesSynthetic
-
Insert Size (bp)700
- Promoter CAG
-
Tag
/ Fusion Protein
- linked to red flouresent protein gene mKateII (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site ClaI (unknown if destroyed)
- 5′ sequencing primer gacaaagagacctacgtcga
- 3′ sequencing primer gctcgtagaaggggaggttg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehCas9
-
SpeciesSynthetic
- Promoter CAG
-
Tag
/ Fusion Protein
- mVenus (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AsisI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer AGTACAACTACAACAGCCAC
- 3′ sequencing primer GGTGCTGGTGTACCTCTTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68345 ; http://n2t.net/addgene:68345 ; RRID:Addgene_68345) -
For your References section:
The CRISPR/Cas9 Minipig-A Transgenic Minipig to Produce Specific Mutations in Designated Tissues. Berthelsen MF, Riedel M, Cai H, Skaarup SH, Alstrup AKO, Dagnaes-Hansen F, Luo Y, Jensen UB, Hager H, Liu Y, Callesen H, Vendelbo MH, Jakobsen JE, Thomsen MK. Cancers (Basel). 2021 Jun 16;13(12). pii: cancers13123024. doi: 10.3390/cancers13123024. 10.3390/cancers13123024 PubMed 34208747