AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
(Plasmid
#68346)
-
PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAmp
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 6200
-
Vector typeMammalian Expression, AAV ; Flp/Frt
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert name3xgRNA;PTENA, p53B,SMAD4A
-
SpeciesSynthetic
-
Insert Size (bp)1050
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ttcgccacctctgacttgag
- 3′ sequencing primer gggcgtacttggcatatgat
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFlPO
-
SpeciesSynthetic
-
Insert Size (bp)1300
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site AflII (unknown if destroyed)
- 5′ sequencing primer tcctacttggcagtacatct
- 3′ sequencing primer atcagcaaggagatgatcgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68346 ; http://n2t.net/addgene:68346 ; RRID:Addgene_68346) -
For your References section:
The CRISPR/Cas9 Minipig-A Transgenic Minipig to Produce Specific Mutations in Designated Tissues. Berthelsen MF, Riedel M, Cai H, Skaarup SH, Alstrup AKO, Dagnaes-Hansen F, Luo Y, Jensen UB, Hager H, Liu Y, Callesen H, Vendelbo MH, Jakobsen JE, Thomsen MK. Cancers (Basel). 2021 Jun 16;13(12). pii: cancers13123024. doi: 10.3390/cancers13123024. 10.3390/cancers13123024 PubMed 34208747