px330_P53 exon 8 gRNA
(Plasmid
#68349)
-
Purposepx330 with gRNA towards P53 exon 8. Cas9 is expressed from a CAG promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneamp
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 8500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP53 exon 8 gRNA
-
gRNA/shRNA sequenceP53 exon 8
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer ttcgccacctctgacttgag
- 3′ sequencing primer gggcgtacttggcatatgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330_P53 exon 8 gRNA was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68349 ; http://n2t.net/addgene:68349 ; RRID:Addgene_68349)