pOPTXGARE
(Plasmid
#68542)
-
Purposecyclic nucleotide reporter for bacteria or plant cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLUC Trap3 (GW)
-
Backbone manufacturerCalderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1)
- Backbone size w/o insert (bp) 7272
- Total vector size (bp) 8300
-
Vector typeBacterial Expression, Plant Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOPTX promoter with GARE
-
Alt nameNTL1 promoter with GARE
-
Alt nameAT1G33440
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1080
-
Mutation5x GARE inserted 190 bp 5' pf ATG (GARE = taacaaa)
-
GenBank IDNM_102069.3
-
Entrez GeneAT1G33440 (a.k.a. AT1G33440, F10C21.11, F10C21_11)
- Promoter OPTX promoter with GARE
-
Tag
/ Fusion Protein
- luciferase (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pBR322ori-F GGGAAACGCCTGGTATCTTT
- 3′ sequencing primer lucNRev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
linker sequence between inserted GARE is 5' gagagcc 3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPTXGARE was a gift from Helen Irving (Addgene plasmid # 68542 ; http://n2t.net/addgene:68542 ; RRID:Addgene_68542) -
For your References section:
A cyclic nucleotide sensitive promoter reporter system suitable for bacteria and plant cells. Wheeler JI, Freihat L, Irving HR. BMC Biotechnol. 2013 Nov 9;13:97. doi: 10.1186/1472-6750-13-97. 10.1186/1472-6750-13-97 PubMed 24206622