Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pC1-FGB (FlincG2)
(Plasmid #49204)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49204 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1 vector
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 4044
  • Total vector size (bp) 5664
  • Modifications to backbone
    The native EGFP was deleted first and then the PCR amplified FlincG2 was cloned at Nhe I and Xho I sites.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FlincG2
  • Alt name
    FGB
  • Alt name
    CR4-C1
  • Species
    B. taurus (bovine); GFP
  • Insert Size (bp)
    1620
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe I (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer CAACTCCGCCCCATTGACGC
  • 3′ sequencing primer None
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Prof. Wolfgang Dostmann at University of Vermont, USA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC1-FGB (FlincG2) was a gift from John Garthwaite (Addgene plasmid # 49204 ; http://n2t.net/addgene:49204 ; RRID:Addgene_49204)
  • For your References section:

    Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging. Bhargava Y, Hampden-Smith K, Chachlaki K, Wood KC, Vernon J, Allerston CK, Batchelor AM, Garthwaite J. Front Mol Neurosci. 2013 Sep 24;6:26. doi: 10.3389/fnmol.2013.00026. 10.3389/fnmol.2013.00026 PubMed 24068983