Skip to main content

pLL3.7 K122 FH-TAZ-ires-GFP-Osteocalcin-promoter-H2B mCherry reporter
(Plasmid #68713)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68713 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.7
  • Modifications to backbone
    Please refer to the paper.
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B mCherry and TAZ/WWTR1
  • Species
    H. sapiens (human)
  • Promoter CMV for TAZ/WWTR1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV promoter
  • 3′ sequencing primer ccctaggaatgctcgtcaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7 K122 FH-TAZ-ires-GFP-Osteocalcin-promoter-H2B mCherry reporter was a gift from Yutaka Hata (Addgene plasmid # 68713 ; http://n2t.net/addgene:68713 ; RRID:Addgene_68713)