pLL3.7 K122 FH-TAZ-ires-GFP-Osteocalcin-promoter-H2B mCherry reporter
(Plasmid
#68713)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68713 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.7
-
Modifications to backbonePlease refer to the paper.
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B mCherry and TAZ/WWTR1
-
SpeciesH. sapiens (human)
- Promoter CMV for TAZ/WWTR1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV promoter
- 3′ sequencing primer ccctaggaatgctcgtcaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL3.7 K122 FH-TAZ-ires-GFP-Osteocalcin-promoter-H2B mCherry reporter was a gift from Yutaka Hata (Addgene plasmid # 68713 ; http://n2t.net/addgene:68713 ; RRID:Addgene_68713)