Skip to main content
Addgene

pX330-sgRNA_Dicer_1
(Plasmid #68807)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68807 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Addgene 42230
  • Backbone size w/o insert (bp) 8506
  • Total vector size (bp) 8509
  • Vector type
    Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA mouse Dicer1
  • gRNA/shRNA sequence
    mouse Dicer1
  • Species
    M. musculus (mouse)
  • GenBank ID
    23405

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-sgRNA_Dicer_1 was a gift from Constance Ciaudo (Addgene plasmid # 68807 ; http://n2t.net/addgene:68807 ; RRID:Addgene_68807)
  • For your References section:

    Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. Bodak M, Cirera-Salinas D, Yu J, Ngondo RP, Ciaudo C. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb. FEB412174 [pii] PubMed 28174687