pX330-sgRNA_Dicer_1
(Plasmid
#68807)
-
Purposespecific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerAddgene 42230
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8509
-
Vector typeMammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA mouse Dicer1
-
gRNA/shRNA sequencemouse Dicer1
-
SpeciesM. musculus (mouse)
-
GenBank ID23405
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-sgRNA_Dicer_1 was a gift from Constance Ciaudo (Addgene plasmid # 68807 ; http://n2t.net/addgene:68807 ; RRID:Addgene_68807) -
For your References section:
Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. Bodak M, Cirera-Salinas D, Yu J, Ngondo RP, Ciaudo C. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb. FEB412174 [pii] PubMed 28174687