Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68807)


Item Catalog # Description Quantity Price (USD)
Plasmid 68807 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Addgene 42230
  • Backbone size w/o insert (bp) 8506
  • Total vector size (bp) 8509
  • Vector type
    Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    sgRNA mouse Dicer1
  • gRNA/shRNA sequence
    mouse Dicer1
  • Species
    M. musculus (mouse)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-sgRNA_Dicer_1 was a gift from Constance Ciaudo (Addgene plasmid # 68807 ; ; RRID:Addgene_68807)
  • For your References section:

    Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. Bodak M, Cirera-Salinas D, Yu J, Ngondo RP, Ciaudo C. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb. FEB412174 [pii] PubMed 28174687