-
PurposeExpresses rat Cx43 (Gja1 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 5893
-
Modifications to backboneEGFP replaced with sfGFP and the V207 in sfGFP mutagenized to K with PCR cloning to monomerize.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGja1
-
Alt nameCx43
-
SpeciesR. norvegicus (rat)
-
Entrez GeneGja1 (a.k.a. Cx43, Cxnk1)
- Promoter cmv
-
Tag
/ Fusion Protein
- monomerized superfolder GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CMV forward primer
- 3′ sequencing primer ACCTCTACAAATGTGGTATGGCTGATTATG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addition of a fluorescent protein tag to the carboxyl-terminus of Cx43 has been shown to eliminate or attenuate interactions with ZO-1 and Occludin in cell culture. Other binding interactions and channel gating properties may be affected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cx43-msfGFP was a gift from David Spray (Addgene plasmid # 69007 ; http://n2t.net/addgene:69007 ; RRID:Addgene_69007) -
For your References section:
Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468