Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLKO-RFP-shCntrl
(Plasmid #69040)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69040 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO-RFP
  • Backbone manufacturer
    Dr. Julie Losman
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    control shRNA
  • gRNA/shRNA sequence
    CAACAAGATGAAGAGCACCAA
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-RFP-shCntrl was a gift from William Kaelin (Addgene plasmid # 69040 ; http://n2t.net/addgene:69040 ; RRID:Addgene_69040)
  • For your References section:

    The myeloma drug lenalidomide promotes the cereblon-dependent destruction of Ikaros proteins. Lu G, Middleton RE, Sun H, Naniong M, Ott CJ, Mitsiades CS, Wong KK, Bradner JE, Kaelin WG Jr. Science. 2014 Jan 17;343(6168):305-9. doi: 10.1126/science.1244917. Epub 2013 Nov 29. 10.1126/science.1244917 PubMed 24292623