mLPx-shZMPSTE24
(Plasmid
#69067)
-
Purposeencodes a shRNA against the protease ZMPSTE24
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMLPx
- Backbone size w/o insert (bp) 6527
- Total vector size (bp) 6629
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA against ZMPSTE24
-
Alt nameshFACE1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)102
-
Entrez GeneZMPSTE24 (a.k.a. FACE-1, FACE1, HGPS, PRO1, RSDM1, STE24, Ste24p)
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequence of the 5' end of the hairpin is GATCATGGATTCTGAAACATT. This difference does not affect the ability of the hairpin to knockdown ZMPSTE24 expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mLPx-shZMPSTE24 was a gift from Gerardo Ferbeyre (Addgene plasmid # 69067 ; http://n2t.net/addgene:69067 ; RRID:Addgene_69067) -
For your References section:
Mutant lamin A links prophase to a p53 independent senescence program. Moiseeva O, Lessard F, Acevedo-Aquino M, Vernier M, Tsantrizos YS, Ferbeyre G. Cell Cycle. 2015 Aug 3;14(15):2408-21. doi: 10.1080/15384101.2015.1053671. Epub 2015 Jun 1. 10.1080/15384101.2015.1053671 PubMed 26029982