Skip to main content

mLPx-shZMPSTE24
(Plasmid #69067)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69067 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MLPx
  • Backbone size w/o insert (bp) 6527
  • Total vector size (bp) 6629
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA against ZMPSTE24
  • Alt name
    shFACE1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    102
  • Entrez Gene
    ZMPSTE24 (a.k.a. FACE-1, FACE1, HGPS, PRO1, RSDM1, STE24, Ste24p)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sequence of the 5' end of the hairpin is GATCATGGATTCTGAAACATT. This difference does not affect the ability of the hairpin to knockdown ZMPSTE24 expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mLPx-shZMPSTE24 was a gift from Gerardo Ferbeyre (Addgene plasmid # 69067 ; http://n2t.net/addgene:69067 ; RRID:Addgene_69067)
  • For your References section:

    Mutant lamin A links prophase to a p53 independent senescence program. Moiseeva O, Lessard F, Acevedo-Aquino M, Vernier M, Tsantrizos YS, Ferbeyre G. Cell Cycle. 2015 Aug 3;14(15):2408-21. doi: 10.1080/15384101.2015.1053671. Epub 2015 Jun 1. 10.1080/15384101.2015.1053671 PubMed 26029982