-
PurposeStabilized lacZ expression vector containing alp7A and hok/sok
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTKW106
- Total vector size (bp) 10768
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namelacZ
-
Insert Size (bp)3074
- Promoter pTac
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ttagactcgagcggccgc
- 3′ sequencing primer atgatagatcccgtcgttttacaacgt
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namealp7A
-
Insert Size (bp)3500
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tcattagcctccaatcttatagtgaaactcc
- 3′ sequencing primer gttgctcagggcgtctgtgt
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namehok
-
Insert Size (bp)579
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer aacaaactccgggaggcagc
- 3′ sequencing primer acaacatcagcaaggagaaaggg
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameplacIq-lacI
-
Insert Size (bp)1139
- Promoter placIq
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer tcactgcccgctttccagt
- 3′ sequencing primer tggtgcaaaacctttcgcgg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's NGS results identified sequence discrepancies relative to the depositor's approximate sequence provided in the annotated GenBank file. These discrepancies are not believed to impact the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTKW106alp7A was a gift from Jeff Hasty (Addgene plasmid # 69360 ; http://n2t.net/addgene:69360 ; RRID:Addgene_69360) -
For your References section:
Programmable probiotics for detection of cancer in urine. Danino T, Prindle A, Kwong GA, Skalak M, Li H, Allen K, Hasty J, Bhatia SN. Sci Transl Med. 2015 May 27;7(289):289ra84. doi: 10.1126/scitranslmed.aaa3519. 10.1126/scitranslmed.aaa3519 PubMed 26019220