pTKW106alp7A
(Plasmid #69360)

• Purpose: Stabilized lacZ expression vector containing alp7A and hok/sok
• Depositing Lab: Jeff Hasty
• Publication: Danino et al Sci Transl Med. 2015 May 27;7(289):289ra84. doi: 10.1126/scitranslmed.aaa3519.

Backbone

• Vector backbone: pTKW106
• Total vector size (bp): 10768
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Mach1
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: lacZ
• Insert Size (bp): 3074
• Promoter: pTac

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: ttagactcgagcggccgc
• 3′ sequencing primer: atgatagatcccgtcgttttacaacgt

Gene/Insert 2

• Gene/Insert name: alp7A
• Insert Size (bp): 3500

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcattagcctccaatcttatagtgaaactcc
• 3′ sequencing primer: gttgctcagggcgtctgtgt

Gene/Insert 3

• Gene/Insert name: hok
• Insert Size (bp): 579

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: aacaaactccgggaggcagc
• 3′ sequencing primer: acaacatcagcaaggagaaaggg

Gene/Insert 4

• Gene/Insert name: placIq-lacI
• Insert Size (bp): 1139
• Promoter: placIq

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: tcactgcccgctttccagt
• 3′ sequencing primer: tggtgcaaaacctttcgcgg

Resource Information

• Supplemental Documents:
  • Annotated GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene's NGS results identified sequence discrepancies relative to the depositor's approximate sequence provided in the annotated GenBank file. These discrepancies are not believed to impact the function of the plasmid.