Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTKW106alp7A
(Plasmid #69360)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69360 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach1
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    lacZ
  • Insert Size (bp)
    3074
  • Promoter pTac

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ttagactcgagcggccgc
  • 3′ sequencing primer atgatagatcccgtcgttttacaacgt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    alp7A
  • Insert Size (bp)
    3500

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcattagcctccaatcttatagtgaaactcc
  • 3′ sequencing primer gttgctcagggcgtctgtgt
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    hok
  • Insert Size (bp)
    579

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer aacaaactccgggaggcagc
  • 3′ sequencing primer acaacatcagcaaggagaaaggg
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    placIq-lacI
  • Insert Size (bp)
    1139
  • Promoter placIq

Cloning Information for Gene/Insert 4

  • Cloning method Unknown
  • 5′ sequencing primer tcactgcccgctttccagt
  • 3′ sequencing primer tggtgcaaaacctttcgcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's NGS results identified sequence discrepancies relative to the depositor's approximate sequence provided in the annotated GenBank file. These discrepancies are not believed to impact the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTKW106alp7A was a gift from Jeff Hasty (Addgene plasmid # 69360 ; http://n2t.net/addgene:69360 ; RRID:Addgene_69360)
  • For your References section:

    Programmable probiotics for detection of cancer in urine. Danino T, Prindle A, Kwong GA, Skalak M, Li H, Allen K, Hasty J, Bhatia SN. Sci Transl Med. 2015 May 27;7(289):289ra84. doi: 10.1126/scitranslmed.aaa3519. 10.1126/scitranslmed.aaa3519 PubMed 26019220