pcDNA 3.2/V5-DEST CDC42EP1 S192A
(Plasmid
#69820)
-
PurposeExpresses CDC42EP1-V5 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA 3.2/V5-DEST
- Backbone size w/o insert (bp) 5394
- Total vector size (bp) 6648
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDC42 effector protein
-
Alt nameCDC42EP1, BORG5, MSE55, CEP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1254
-
MutationS192A
-
Entrez GeneCDC42EP1 (a.k.a. BORG5, CEP1, MSE55)
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGCACCAAAATCAACGGGACTTTC
- 3′ sequencing primer GTCTCCTTCCGTGTTTCAGTTAGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVector is Gateway and cDNA is from Orfeome library (Open Biosystems)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA 3.2/V5-DEST CDC42EP1 S192A was a gift from Anne Brunet (Addgene plasmid # 69820 ; http://n2t.net/addgene:69820 ; RRID:Addgene_69820) -
For your References section:
Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Schaffer BE, Levin RS, Hertz NT, Maures TJ, Schoof ML, Hollstein PE, Benayoun BA, Banko MR, Shaw RJ, Shokat KM, Brunet A. Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8. 10.1016/j.cmet.2015.09.009 PubMed 26456332