-
PurposeBacterial expression plasmid containing SpyCatcher-ELP-GFP fusion. SpyCatcher forms a covalent bond with SpyTag and can be used to label plasma membrane localized SpyTag-C1C2 in live cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE-80L
- Backbone size w/o insert (bp) 5378
- Total vector size (bp) 6791
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyCatcher-ELP-GFP
-
Insert Size (bp)1413
- Promoter T5 promoter/lac operator element
-
Tags
/ Fusion Proteins
- GFP (C terminal on insert)
- TEV Tag (N terminal on insert)
- 6x His Tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGCTTTGTGAGCGGATAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE80L-SpyCatcher-ELP-GFP was a gift from Viviana Gradinaru (Addgene plasmid # 69835 ; http://n2t.net/addgene:69835 ; RRID:Addgene_69835) -
For your References section:
Genetically Encoded Spy Peptide Fusion System to Detect Plasma Membrane-Localized Proteins In Vivo. Bedbrook CN, Kato M, Ravindra Kumar S, Lakshmanan A, Nath RD, Sun F, Sternberg PW, Arnold FH, Gradinaru V. Chem Biol. 2015 Aug 20;22(8):1108-21. doi: 10.1016/j.chembiol.2015.06.020. Epub 2015 Jul 23. 10.1016/j.chembiol.2015.06.020 PubMed 26211362