AP568-2
(Plasmid
#70047)
-
Purposeco-expression of Cas9 and crRNA 589 target sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDD162
-
Backbone manufacturerGoldstein lab Plasmid 47549
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA for dpy‐10
-
gRNA/shRNA sequencegctaccataggcaccacgag
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tatgaaatgcctacaccctctc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AP568-2 was a gift from Geraldine Seydoux (Addgene plasmid # 70047 ; http://n2t.net/addgene:70047 ; RRID:Addgene_70047) -
For your References section:
High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Paix A, Folkmann A, Rasoloson D, Seydoux G. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17. 10.1534/genetics.115.179382 PubMed 26187122