Skip to main content

AP568-2
(Plasmid #70047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70047 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDD162
  • Backbone manufacturer
    Goldstein lab Plasmid 47549
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA for dpy‐10
  • gRNA/shRNA sequence
    gctaccataggcaccacgag

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AP568-2 was a gift from Geraldine Seydoux (Addgene plasmid # 70047 ; http://n2t.net/addgene:70047 ; RRID:Addgene_70047)
  • For your References section:

    High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Paix A, Folkmann A, Rasoloson D, Seydoux G. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17. 10.1534/genetics.115.179382 PubMed 26187122