-
PurposeEncode YTHDF3 isoform a with N-terminal GST tag for E. coli expression
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEx-4T-1
- Backbone size w/o insert (bp) 4969
- Total vector size (bp) 6712
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYTH N(6)-methyladenosine RNA binding protein 3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1758
-
GenBank IDNM_152758.5
-
Entrez GeneYTHDF3 (a.k.a. DF3)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer GGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEx-4T-1-YTHDF3 was a gift from Chuan He (Addgene plasmid # 70088 ; http://n2t.net/addgene:70088 ; RRID:Addgene_70088) -
For your References section:
N6-methyladenosine-dependent regulation of messenger RNA stability. Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, Ren B, Pan T, He C. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27. 10.1038/nature12730 PubMed 24284625