-
PurposeExpresses RGVG-M6 T7 RNA polymerase variant with enhanced transcription of 2' modified RNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepQE
-
Backbone manufacturerQiagen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse BL21-gold for protein expression in E. coli
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRGVG-M6 T7 RNA polymerase
-
SpeciesT7 bacteriophage
-
Insert Size (bp)2685
- Promoter T5/Lac
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACG
- 3′ sequencing primer CATCTGGATTTGTTCAGAACGCTCGGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE-WT-RGVG-M6 was a gift from Andrew Ellington (Addgene plasmid # 70172 ; http://n2t.net/addgene:70172 ; RRID:Addgene_70172) -
For your References section:
Transcription yield of fully 2'-modified RNA can be increased by the addition of thermostabilizing mutations to T7 RNA polymerase mutants. Meyer AJ, Garry DJ, Hall B, Byrom MM, McDonald HG, Yang X, Yin YW, Ellington AD. Nucleic Acids Res. 2015 Sep 3;43(15):7480-8. doi: 10.1093/nar/gkv734. Epub 2015 Jul 24. 10.1093/nar/gkv734 PubMed 26209133