-
PurposeExpresses NLS-dCas9-GFP11x7-NLS in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHRdSV40-NLS-dCas9-24xGCN4_v4-NLS-P2A-BFP-dWPRE (addgene #60910)
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 14000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-dCas9-GFP11x7-NLS
-
Alt namedCas9-GFP11x7
-
SpeciesSynthetic
-
Insert Size (bp)5599
-
Tag
/ Fusion Protein
- GFP11x7 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCATGCATCTCAATTAGTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is a stop codon found between 7xGFP11 and BFP. BFP expression is not necessary for the imaging system described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHRm-NLS-dCas9-GFP11x7-NLS was a gift from Bo Huang (Addgene plasmid # 70224 ; http://n2t.net/addgene:70224 ; RRID:Addgene_70224) -
For your References section:
Versatile protein tagging in cells with split fluorescent protein. Kamiyama D, Sekine S, Barsi-Rhyne B, Hu J, Chen B, Gilbert LA, Ishikawa H, Leonetti MD, Marshall WF, Weissman JS, Huang B. Nat Commun. 2016 Mar 18;7:11046. doi: 10.1038/ncomms11046. 10.1038/ncomms11046 PubMed 26988139