-
PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ets2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV-tetO
-
Backbone manufacturerHochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
- Backbone size w/o insert (bp) 8370
- Total vector size (bp) 9830
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEts2
-
Alt nameE26 avian leukemia oncogene 2, 3' domain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1450
-
GenBank IDNM_011809
-
Entrez GeneEts2 (a.k.a. Ets-2)
- Promoter tetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
- 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The cDNA sequence of murine Ets2 was amplified from undifferentiated trophoblast stem cells and inserted into the pCR2.1 vector. From there it was excised by EcoRI digest and ligated into the pLV-tetO vector via the EcoRI site. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-tetO-Ets2 was a gift from Hubert Schorle (Addgene plasmid # 70272 ; http://n2t.net/addgene:70272 ; RRID:Addgene_70272) -
For your References section:
Direct Induction of Trophoblast Stem Cells from Murine Fibroblasts. Kubaczka C, Senner CE, Cierlitza M, Arauzo-Bravo MJ, Kuckenberg P, Peitz M, Hemberger M, Schorle H. Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005. 10.1016/j.stem.2015.08.005 PubMed 26412560