-
PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Tfap2a
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV-tetO
-
Backbone manufacturerHochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
- Backbone size w/o insert (bp) 8370
- Total vector size (bp) 10300
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTfap2a
-
Alt nametranscription factor AP-2, alpha
-
Alt nameAp2, Ap-2 (a), AP2alpha, AP-2 alpha, Ap2tf, Tcfap2a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1900
-
GenBank IDNM_001301674
-
Entrez GeneTfap2a (a.k.a. AP-2, AP2alpha, Ap-2 (a), Ap2, Ap2tf, Tcfap2a)
- Promoter tetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
- 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The cDNA sequence of murine Tfap2a (coding region and partially 5' and 3' UTR) was inserted into the pLV-tetO vector via the EcoRI site. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-tetO-Tfap2a was a gift from Hubert Schorle (Addgene plasmid # 70274 ; http://n2t.net/addgene:70274 ; RRID:Addgene_70274) -
For your References section:
Direct Induction of Trophoblast Stem Cells from Murine Fibroblasts. Kubaczka C, Senner CE, Cierlitza M, Arauzo-Bravo MJ, Kuckenberg P, Peitz M, Hemberger M, Schorle H. Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005. 10.1016/j.stem.2015.08.005 PubMed 26412560
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/70/70274/70274-map_1O_PeHrjFGOK.png.940x940_q85_autocrop.png)