pRL692
(Plasmid
#70284)
-
PurposeTn5-based plasmid for transposition in Synechococcus sp. strain PCC 7942
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
- Total vector size (bp) 7738
-
Vector typeBacterial Expression
-
Selectable markersErythromycin for cyanobacteria
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin and Streptomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTransposon Tn5-692
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAT-F (GTTTGTGATGGCTTCCATGTC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Tn5 derivative Tn5-692 (in plasmid pRL692; GenBank accession no. AF424805) contains a pMB1 oriV; and bears mutations (Zhou, et al. 1998 J. Mol. Biol. 276:913–925) that increase its rate of transposition ca. 100-fold relative to that of Tn5-1058 (Wolk, et al. 1991. Proc. Natl. Acad. Sci. USA 88:5355–5359), providing large numbers of transposon mutants. The erythromycin-resistance gene came from Horinouchi and Weisblum (J. Bacteriol. 150: 804-814, 1982) and the streptomycin-spectinomycin gene came from the Ω-fragment described by Prentki and Krisch (Gene 29, 303-313, 1984) and was purchased as an EcoRI fragment from Amersham.
NOTE--Because Tn5-692 appears able to transpose repeatedly, the user is cautioned not to delay storing strains whose phenotype is of interest.
Additional references:
Miyagishima S-y, Wolk CP, Osteryoung KW (2005) Identification of cyanobacterial cell division genes by comparative and mutational analyses. Mol Microbiol 56: 126-143
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRL692 was a gift from Peter Wolk (Addgene plasmid # 70284 ; http://n2t.net/addgene:70284 ; RRID:Addgene_70284) -
For your References section:
A novel gene that bears a DnaJ motif influences cyanobacterial cell division. Koksharova OA, Wolk CP. J Bacteriol. 2002 Oct;184(19):5524-8. PubMed 12218043