Skip to main content
Addgene

pDD286 (TagRFP^SEC^3xMyc)
(Plasmid #70684)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70684 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19 (modified)
  • Backbone size w/o insert (bp) 2600
  • Total vector size (bp) 10500
  • Modifications to backbone
    Addition of ccdB markers to facilitate homology arm cloning
  • Vector type
    Worm Expression, Cre/Lox, CRISPR
  • Selectable markers
    Hygromycin ; sqt-1(d) (worm phenotypic marker)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Turbo
  • Growth instructions
    The dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and check test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TagRFP-T-C1^SEC^3xFlag
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    6600
  • Tags / Fusion Proteins
    • C. elegans codon-optimized TagRFP-T
    • 3xMyc

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
  • 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pDD286 is a derivative of our published TagRFP-SEC vector pDD284 (Dickinson et al. Genetics 2015, Addgene plasmid number 66825). It has a 3xMyc tag in place of 3xFlag, and Lox2272 sites in place of LoxP. These features allow pDD286 to be used in a genetic background that has already been modified using a green FP-SEC vector, without conflicts between epitope tags and Lox sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDD286 (TagRFP^SEC^3xMyc) was a gift from Bob Goldstein (Addgene plasmid # 70684 ; http://n2t.net/addgene:70684 ; RRID:Addgene_70684)