Skip to main content

pLV-tetO-Tpbpa
(Plasmid #70698)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70698 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-tetO
  • Backbone manufacturer
    Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
  • Total vector size (bp) 8370
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Trophoblast specific protein alpha
  • Alt name
    Tpbpa
  • Alt name
    4311, clone 4311, Tb1, Tb-1, Tpbp
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    722
  • GenBank ID
    NM_009411
  • Entrez Gene
    Tpbpa (a.k.a. AV033951, Tb-1, Tb1, Tpbp, b2b1247Clo)
  • Promoter tetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
  • 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The coding sequence for murine Tpbpa (together with parts of the 5' and 3' UTR) was inserted into the EcoRI site of the pLV-tetO vector (pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, Addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-tetO-Tpbpa was a gift from Hubert Schorle (Addgene plasmid # 70698 ; http://n2t.net/addgene:70698 ; RRID:Addgene_70698)
  • For your References section:

    Direct Induction of Trophoblast Stem Cells from Murine Fibroblasts. Kubaczka C, Senner CE, Cierlitza M, Arauzo-Bravo MJ, Kuckenberg P, Peitz M, Hemberger M, Schorle H. Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005. 10.1016/j.stem.2015.08.005 PubMed 26412560