Skip to main content

pCW-Flag-CtIP
(Plasmid #71108)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71108 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    David Root; Addgene plasmid #41393
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CtlP
  • Species
    H. sapiens (human)
  • Mutation
    Please see Depositor Comments
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

siRNA resistant construct. Custom CtlP siRNA (Dharmacon) sequence: GCUAAAACAGGAACGAAUC

Addgene NGS identified L278I and M544T point mutations within the CtlP insert. The depositing laboratory has confirmed that the plasmid functions as described in their publication

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-Flag-CtIP was a gift from Daniel Durocher (Addgene plasmid # 71108 ; http://n2t.net/addgene:71108 ; RRID:Addgene_71108)
  • For your References section:

    A mechanism for the suppression of homologous recombination in G1 cells. Orthwein A, Noordermeer SM, Wilson MD, Landry S, Enchev RI, Sherker A, Munro M, Pinder J, Salsman J, Dellaire G, Xia B, Peter M, Durocher D. Nature. 2015 Dec 9. doi: 10.1038/nature16142. 10.1038/nature16142 PubMed 26649820