-
Purposemammalian expession of Flag-CtlP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71108 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerDavid Root; Addgene plasmid #41393
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCtlP
-
SpeciesH. sapiens (human)
-
MutationPlease see Depositor Comments
- Promoter TRE promoter, Tet ON
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
siRNA resistant construct. Custom CtlP siRNA (Dharmacon) sequence: GCUAAAACAGGAACGAAUC
Addgene NGS identified L278I and M544T point mutations within the CtlP insert. The depositing laboratory has confirmed that the plasmid functions as described in their publication
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-Flag-CtIP was a gift from Daniel Durocher (Addgene plasmid # 71108 ; http://n2t.net/addgene:71108 ; RRID:Addgene_71108) -
For your References section:
A mechanism for the suppression of homologous recombination in G1 cells. Orthwein A, Noordermeer SM, Wilson MD, Landry S, Enchev RI, Sherker A, Munro M, Pinder J, Salsman J, Dellaire G, Xia B, Peter M, Durocher D. Nature. 2015 Dec 9. doi: 10.1038/nature16142. 10.1038/nature16142 PubMed 26649820