Skip to main content

p2R3a-Tq2CFP-OcsT
(Plasmid #71268)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71268 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p2RP3-pGEMteasy
  • Backbone manufacturer
    ampicillin resistant variant of pDONR-P2R-P3. attP2R-ccdB-cmR-attP3 sequences of pDONR-P2R-P3 were cloned into pGEMt-easy
  • Vector type
    Gateway

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tq2CFP
  • Alt name
    turquoise2
  • Tags / Fusion Proteins
    • 4xGly linker (N terminal on insert)
    • octaline synthase terminator (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer M13pUC-Fwd
  • 3′ sequencing primer OCSterm-R (GGCGGTAAGGATCTGAGCTA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2R3a-Tq2CFP-OcsT was a gift from Ari Pekka Mähönen (Addgene plasmid # 71268 ; http://n2t.net/addgene:71268 ; RRID:Addgene_71268)
  • For your References section:

    MultiSite Gateway compatible cell type-specific gene inducible system for plants. Siligato R, Wang X, Yadav SR, Lehesranta S, Ma G, Ursache R, Sevilem I, Zhang J, Gorte M, Prasad K, Wrzaczek M, Heidstra R, Murphy A, Scheres B, Mahonen AP. Plant Physiol. 2015 Dec 7. pii: pp.01246.2015. 10.1104/pp.15.01246 PubMed 26644504