pCoHygro L16_shRNA of spliced Copia
(Plasmid
#71389)
-
Purposeknock down expression of spliced Copia in Drosophila melanogaster
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71389 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCoHygro
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4526
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCopia
-
gRNA/shRNA sequenceGTTCGACTTTGCAGCCTGAAATACGGCACGAGTAGGAAAAGCCGAGTCAAATGCCGAATGCAGAGTCTCATTACAGCACAATCAACTCAAGAAAAACTCGACACTTTTTTACCATTTGCACTTAAATCCTTTTTTATTCGTTATGTATACTTTTTTTGGTCCCTAACCAAAACAAAACCAAACTCTCTTAGTCGTGCCTCTATATTTAAAACTATCAATTTATTATAGTCAATAAATCGAACTGTGTTTTCAACAAACGAACAATAGGACACTTTGATTCTAAAGGAAATTTTGAAAATCTTAAGCAGAGGGTTCTTAAGACCATTTGCCAATTCTTATAATTCTCAACTGCTCTTTCCTGATGTTGATCATTTATATAGGTATGTTTTCCTCAATACTTCG
-
SpeciesD. melanogaster (fly)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer pCo-Hygro-F324 (tgtgctgcaaggcgattaag)
- 3′ sequencing primer pCo-Hygro-R512 (tatattccaacagatgatgagg) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCoHygro L16_shRNA of spliced Copia was a gift from Timothy Nilsen (Addgene plasmid # 71389 ; http://n2t.net/addgene:71389 ; RRID:Addgene_71389)