-
Purpose(Empty Backbone) Base plasmid for sgRNA cloning with Hygromycin resistance and Tol2 transposon arms
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71485 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep2Tol2
- Promoter U6
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR) was a gift from Richard Sherwood (Addgene plasmid # 71485 ; http://n2t.net/addgene:71485 ; RRID:Addgene_71485) -
For your References section:
Cloning-free CRISPR. Arbab M, Srinivasan S, Hashimoto T, Geijsen N, Sherwood RI. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022. 10.1016/j.stemcr.2015.09.022 PubMed 26527385