pKM342
(Plasmid
#71486)
-
PurposeContains loxP-hyg-loxP cassette for recombineering; HygR, AmpR.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepKM328
-
Backbone manufacturerKenan Murphy
- Backbone size w/o insert (bp) 2741
- Total vector size (bp) 4035
-
Modifications to backboneInsertion of loxP-Hyg-logP cassette
-
Vector typeBacterial Expression ; Source of loxP-hyg-loxP for PCR amplification.
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameloxP-hyg-loxP cassette
-
SpeciesSynthetic
-
Insert Size (bp)1231
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer GGGATGTGCTGCAAGGCGATT
- 3′ sequencing primer GCACCCCAGGCTTTACACTTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJ. Murry from Eric Rubin's lab. The loxP-hyg-loxP cassette was derived from plasmid pJM1.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences:
CGCTCTAGAACTAGTGGATCC
ATGCCTGCAGGTCGACTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM342 was a gift from Kenan Murphy (Addgene plasmid # 71486 ; http://n2t.net/addgene:71486 ; RRID:Addgene_71486) -
For your References section:
Mycobacterial recombineering. Murphy KC, Papavinasasundaram K, Sassetti CM. Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10. 10.1007/978-1-4939-2450-9_10 PubMed 25779316