Skip to main content
Addgene

pKM343
(Plasmid #71487)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71487 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJM1
  • Backbone manufacturer
    Jeffery Murry - Eric Rubin Lab
  • Total vector size (bp) 5255
  • Modifications to backbone
    Base pair in pJM1 at position 2008 was changed from G to C to remove a stop codon following the second loxP site.
  • Vector type
    Bacterial Expression ; Source of loxP-hyg-cat- loxP for PCR amplification.
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Select with 20 ug/ml chloramphenicol
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    loxP-hyg-cat-loxP
  • Insert Size (bp)
    1985

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCTCTAGAACTAGTGGATCC
  • 3′ sequencing primer GCCATTGGGATATATCAACGGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jeffery Murry

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector contains a hyg-cat cassette, flanked by loxP sites, that can be used for the construction of recombineeng substrates for M. smegmatis or M. tuberculosis. It contains a 1 bp change (relative to starting plasmid pJM1) at position 2008 (G to C) that eliminate a potential stop codon that could interfere with expression of downstream functions following excision of the cassette from the chromosome by Cre recombinase.

The hygromycin resistance gene encodes M13I and I111T variants compared to the NCBI reference [ADL66925.1]. These variants should not interfere with function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM343 was a gift from Kenan Murphy (Addgene plasmid # 71487 ; http://n2t.net/addgene:71487 ; RRID:Addgene_71487)
  • For your References section:

    Mycobacterial recombineering. Murphy KC, Papavinasasundaram K, Sassetti CM. Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10. 10.1007/978-1-4939-2450-9_10 PubMed 25779316