Skip to main content

pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
(Plasmid #71707)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71707 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Zhang lab, Addgene plasmid 42230
  • Total vector size (bp) 8854
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9 fused to human Geminin
  • Alt name
    hSpCas9-hGem(1/110)
  • Alt name
    hCas9-hGem(1/110)
  • Alt name
    GEMININ
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4614
  • Entrez Gene
    GMNN (a.k.a. Gem, MGORS6)
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • hGEM(1/110) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pCBhProF (AGGGATGGTTGGTTGGTGGG)
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT or BGH-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) was a gift from Giulio Draetta (Addgene plasmid # 71707 ; http://n2t.net/addgene:71707 ; RRID:Addgene_71707)
  • For your References section:

    Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Gutschner T, Haemmerle M, Genovese G, Draetta GF, Chin L. Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019. 10.1016/j.celrep.2016.01.019 PubMed 26854237