-
PurposeA human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerZhang lab, Addgene plasmid 42230
- Total vector size (bp) 8854
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized S. pyogenes Cas9 fused to human Geminin
-
Alt namehSpCas9-hGem(1/110)
-
Alt namehCas9-hGem(1/110)
-
Alt nameGEMININ
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4614
-
Entrez GeneGMNN (a.k.a. Gem, MGORS6)
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- hGEM(1/110) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pCBhProF (AGGGATGGTTGGTTGGTGGG)
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT or BGH-rev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) was a gift from Giulio Draetta (Addgene plasmid # 71707 ; http://n2t.net/addgene:71707 ; RRID:Addgene_71707) -
For your References section:
Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Gutschner T, Haemmerle M, Genovese G, Draetta GF, Chin L. Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019. 10.1016/j.celrep.2016.01.019 PubMed 26854237