Skip to main content
Addgene

pCDH-CB1-HIF2a-GFP-T2A-Puro
(Plasmid #71708)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71708 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDH
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HIF2A
  • Alt name
    EPAS1
  • Species
    H. sapiens (human)
  • Entrez Gene
    EPAS1 (a.k.a. ECYT4, HIF2A, HLF, MOP2, PASD2, bHLHe73)
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pcDL-F (GTTGCCTTTACTTCTAGGCCT)
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-CB1-HIF2a-GFP-T2A-Puro was a gift from Eric Jonasch & Xiande Liu (Addgene plasmid # 71708 ; http://n2t.net/addgene:71708 ; RRID:Addgene_71708)
  • For your References section:

    Autophagy mediates HIF2alpha degradation and suppresses renal tumorigenesis. Liu XD, Yao J, Tripathi DN, Ding Z, Xu Y, Sun M, Zhang J, Bai S, German P, Hoang A, Zhou L, Jonasch D, Zhang X, Conti CJ, Efstathiou E, Tannir NM, Eissa NT, Mills GB, Walker CL, Jonasch E. Oncogene. 2015 May 7;34(19):2450-60. doi: 10.1038/onc.2014.199. Epub 2014 Jul 7. 10.1038/onc.2014.199 PubMed 24998849