Skip to main content

Venus-tagged Apollo-NADP+
(Plasmid #71797)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71797 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEYFP N1
  • Backbone size w/o insert (bp) 3953
  • Total vector size (bp) 6233
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Apollo-NADP+
  • Species
    Synthetic
  • Insert Size (bp)
    2280
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-tagged Apollo-NADP+ was a gift from Jonathan Rocheleau (Addgene plasmid # 71797 ; http://n2t.net/addgene:71797 ; RRID:Addgene_71797)
  • For your References section:

    Apollo-NADP: a spectrally tunable family of genetically encoded sensors for NADP. Cameron WD, Bui CV, Hutchinson A, Loppnau P, Graslund S, Rocheleau JV. Nat Methods. 2016 Feb 15. doi: 10.1038/nmeth.3764. 10.1038/nmeth.3764 PubMed 26878383