Cerulean-tagged Apollo-NADP+
(Plasmid
#71800)
-
PurposeExpresses Cerulean-tagged Apollo-NADP+ in mammalian cells as a reporter for cytoplasmic NADP+
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepECFP N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3953
- Total vector size (bp) 6233
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameApollo-NADP+
-
SpeciesSynthetic
-
Insert Size (bp)2280
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cerulean-tagged Apollo-NADP+ was a gift from Jonathan Rocheleau (Addgene plasmid # 71800 ; http://n2t.net/addgene:71800 ; RRID:Addgene_71800) -
For your References section:
Apollo-NADP: a spectrally tunable family of genetically encoded sensors for NADP. Cameron WD, Bui CV, Hutchinson A, Loppnau P, Graslund S, Rocheleau JV. Nat Methods. 2016 Feb 15. doi: 10.1038/nmeth.3764. 10.1038/nmeth.3764 PubMed 26878383