Skip to main content
Addgene

Sema3c(L)-Fc-His
(Plasmid #72141)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72141 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMVi-SV40ori
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sema3c
  • Alt name
    Semaphorin 3C
  • Alt name
    NCBI gene ID 20348; Reference sequence NM_013657.5
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2223
  • Entrez Gene
    Sema3c (a.k.a. 1110036B02Rik, SemE, Semae)
  • Promoter CMV
  • Tag / Fusion Protein
    • Fc-His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GTCAGAGGTAACTCCCGTTGC
  • 3′ sequencing primer ATCATGAGGGTGTCCTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sema3c(L)-Fc-His was a gift from Woj Wojtowicz (Addgene plasmid # 72141 ; http://n2t.net/addgene:72141 ; RRID:Addgene_72141)
  • For your References section:

    An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812