pTT3 Unc5D-FLAG
(Plasmid
#72197)
-
PurposeExpresses full-length Unc5d with a C-terminal FLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTT3
-
Backbone manufacturerYves Durocher, National Research Council of Canada-Biotechnology Research Institute
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUnc5d
-
Alt nameUnc5h4
-
Alt nameNCBI gene ID 210801; Reference sequence XM_006509055.3
-
SpeciesM. musculus (mouse)
-
GenBank IDXM_006509055.3
-
Entrez GeneUnc5d (a.k.a. D930029E11Rik, Unc5h4, mKIAA1777)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer CAGTTTCCAAAAACGAGGAGG
- 3′ sequencing primer TATGTCCTTCCGAGTGAGAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTT3 Unc5D-FLAG was a gift from Woj Wojtowicz (Addgene plasmid # 72197 ; http://n2t.net/addgene:72197 ; RRID:Addgene_72197) -
For your References section:
An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812