pVenus-PICK1-shRNA
(Plasmid
#72575)
-
PurposeExpresses shRNA against PICK1 as well as the marker Venus fluorescent protein
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72575 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSuper
-
Backbone manufacturerOligoengine
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 5500
-
Modifications to backboneCMV-Venus cassette is inserted into the EcoRI and NotI sites.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer gccctgcaatatttgcatgtcg
- 3′ sequencing primer ATTAACCCTCACTAAAGGGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVenus-PICK1-shRNA was a gift from Victor Anggono & Richard Huganir (Addgene plasmid # 72575 ; http://n2t.net/addgene:72575 ; RRID:Addgene_72575) -
For your References section:
PICK1 loss of function occludes homeostatic synaptic scaling. Anggono V, Clem RL, Huganir RL. J Neurosci. 2011 Feb 9;31(6):2188-96. doi: 10.1523/JNEUROSCI.5633-10.2011. 10.1523/JNEUROSCI.5633-10.2011 PubMed 21307255